ID: 966300713_966300721

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 966300713 966300721
Species Human (GRCh38) Human (GRCh38)
Location 3:178476658-178476680 3:178476701-178476723
Sequence CCACGCTTTCTTCACTTCTCCAA TGAACGACAATTGGTAGTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 362} {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!