ID: 966305125_966305131

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 966305125 966305131
Species Human (GRCh38) Human (GRCh38)
Location 3:178523114-178523136 3:178523165-178523187
Sequence CCAGATGAAAAAGAGAGGAGAAG CAGCATGAGCACAAGCAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 45, 4: 473} {0: 1, 1: 0, 2: 9, 3: 57, 4: 535}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!