ID: 966328902_966328905

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 966328902 966328905
Species Human (GRCh38) Human (GRCh38)
Location 3:178789553-178789575 3:178789597-178789619
Sequence CCTGGCAGAAGCTGCATGGCACA GAGAAGAGCACAGTGATTGTGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 11, 3: 43, 4: 338} {0: 1, 1: 3, 2: 12, 3: 73, 4: 368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!