ID: 966362859_966362875

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 966362859 966362875
Species Human (GRCh38) Human (GRCh38)
Location 3:179148624-179148646 3:179148673-179148695
Sequence CCGGTAGCGGGTGCGGTGGGAAT CCGGGCGCGCCCGCCGTGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 44} {0: 1, 1: 0, 2: 1, 3: 1, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!