ID: 966362868_966362875

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 966362868 966362875
Species Human (GRCh38) Human (GRCh38)
Location 3:179148652-179148674 3:179148673-179148695
Sequence CCGGGTGGGTGCCGGAGACTCCC CCGGGCGCGCCCGCCGTGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 162} {0: 1, 1: 0, 2: 1, 3: 1, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!