ID: 966445690_966445696

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 966445690 966445696
Species Human (GRCh38) Human (GRCh38)
Location 3:179998529-179998551 3:179998574-179998596
Sequence CCTGCCATCTTCTGCAGATAACT CTTGGTCTGTTACTGGGCTTTGG
Strand - +
Off-target summary {0: 185, 1: 187, 2: 104, 3: 111, 4: 225} {0: 14, 1: 178, 2: 170, 3: 117, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!