ID: 966504464_966504467

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 966504464 966504467
Species Human (GRCh38) Human (GRCh38)
Location 3:180684017-180684039 3:180684035-180684057
Sequence CCTACTGCTCTCCATCTCCACTG CACTGCCACTACTCTAATTTAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 24, 3: 95, 4: 710} {0: 1, 1: 0, 2: 5, 3: 24, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!