ID: 966505261_966505265

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 966505261 966505265
Species Human (GRCh38) Human (GRCh38)
Location 3:180693562-180693584 3:180693581-180693603
Sequence CCATCCATGTGAGCACAGCACAA ACAAAAACAAGGCTGGTATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 190} {0: 1, 1: 0, 2: 1, 3: 22, 4: 396}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!