ID: 966749723_966749726

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 966749723 966749726
Species Human (GRCh38) Human (GRCh38)
Location 3:183310470-183310492 3:183310496-183310518
Sequence CCAGCCTGGGCAACAGAGTGAGA CAACTCAAAAAAAAAATTACCGG
Strand - +
Off-target summary {0: 21776, 1: 73212, 2: 167026, 3: 221294, 4: 302558} {0: 1, 1: 0, 2: 16, 3: 263, 4: 3870}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!