ID: 966757457_966757467

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 966757457 966757467
Species Human (GRCh38) Human (GRCh38)
Location 3:183384762-183384784 3:183384810-183384832
Sequence CCTGGTTCTGTCTGGGCAGCAGG AGTTGGAGCTCTATACTCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 307} {0: 1, 1: 0, 2: 0, 3: 8, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!