ID: 966762015_966762022

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 966762015 966762022
Species Human (GRCh38) Human (GRCh38)
Location 3:183427586-183427608 3:183427599-183427621
Sequence CCCACCCTACTCCCGTCAGAAGC CGTCAGAAGCAGCTAACGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 126} {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!