ID: 966783686_966783690

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 966783686 966783690
Species Human (GRCh38) Human (GRCh38)
Location 3:183607362-183607384 3:183607377-183607399
Sequence CCTTCCACGGTCTCCCTCTGATG CTCTGATGCCGAGCCGAAGCTGG
Strand - +
Off-target summary {0: 87, 1: 19, 2: 6, 3: 18, 4: 219} {0: 419, 1: 561, 2: 478, 3: 168, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!