ID: 966787902_966787910

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 966787902 966787910
Species Human (GRCh38) Human (GRCh38)
Location 3:183636713-183636735 3:183636732-183636754
Sequence CCCTGGGCCATTCTTCCCGCCCC CCCCCTTGAAGGTGATCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 15, 4: 237} {0: 1, 1: 0, 2: 0, 3: 4, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!