ID: 966807585_966807590

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 966807585 966807590
Species Human (GRCh38) Human (GRCh38)
Location 3:183819042-183819064 3:183819067-183819089
Sequence CCAAGGTGGAAGTGTCCAGCTAG GGGCCTGGCACCCACGTGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 131} {0: 1, 1: 0, 2: 0, 3: 16, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!