ID: 966830733_966830738

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 966830733 966830738
Species Human (GRCh38) Human (GRCh38)
Location 3:184006132-184006154 3:184006165-184006187
Sequence CCACCTGGGCTCCACACCAATCG TTACCTCAGCCGGAGATCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 121} {0: 1, 1: 0, 2: 0, 3: 6, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!