ID: 966847168_966847175

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 966847168 966847175
Species Human (GRCh38) Human (GRCh38)
Location 3:184139632-184139654 3:184139675-184139697
Sequence CCCACTGGGAGTCTCTTTGGAAT CATAGGGTTTGCTAGGTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 148} {0: 1, 1: 0, 2: 1, 3: 7, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!