ID: 966863540_966863549

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 966863540 966863549
Species Human (GRCh38) Human (GRCh38)
Location 3:184243766-184243788 3:184243805-184243827
Sequence CCATGGCACTACTGCCTTTTCTC GAGGGCAAACAGCAGGAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 336} {0: 1, 1: 0, 2: 4, 3: 44, 4: 518}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!