ID: 966867816_966867821

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 966867816 966867821
Species Human (GRCh38) Human (GRCh38)
Location 3:184270191-184270213 3:184270230-184270252
Sequence CCACATTATTTTGTACCTCCTCC CTATTTCTCCAGCCCTGAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 257} {0: 1, 1: 0, 2: 1, 3: 18, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!