ID: 966872436_966872446

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 966872436 966872446
Species Human (GRCh38) Human (GRCh38)
Location 3:184299569-184299591 3:184299601-184299623
Sequence CCGCGCTGTCACCTCCGCCGTCC CTCACCACCGCCGCGTGAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 287} {0: 1, 1: 0, 2: 1, 3: 3, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!