ID: 966872437_966872446

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 966872437 966872446
Species Human (GRCh38) Human (GRCh38)
Location 3:184299580-184299602 3:184299601-184299623
Sequence CCTCCGCCGTCCCCACCAACCCT CTCACCACCGCCGCGTGAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 526} {0: 1, 1: 0, 2: 1, 3: 3, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!