ID: 966910519_966910537

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 966910519 966910537
Species Human (GRCh38) Human (GRCh38)
Location 3:184557127-184557149 3:184557170-184557192
Sequence CCAGCTGCCTGGGGCCTGGAGGG TGGGGTTTGGGAATGTGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 88, 4: 620} {0: 1, 1: 0, 2: 3, 3: 34, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!