ID: 966921259_966921272

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 966921259 966921272
Species Human (GRCh38) Human (GRCh38)
Location 3:184613136-184613158 3:184613189-184613211
Sequence CCTCACAAACCGGGCAACCAGAA TCTGATACCCAGAGTGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 64} {0: 1, 1: 0, 2: 1, 3: 24, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!