ID: 966930463_966930471

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 966930463 966930471
Species Human (GRCh38) Human (GRCh38)
Location 3:184672425-184672447 3:184672453-184672475
Sequence CCCACTTACCACGTGTTGGATGG TCCATTAAGGATGGGATGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 46} {0: 1, 1: 1, 2: 2, 3: 11, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!