ID: 967006070_967006078

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 967006070 967006078
Species Human (GRCh38) Human (GRCh38)
Location 3:185383618-185383640 3:185383659-185383681
Sequence CCATGTAATTTCTGCACATACTG CCATAAGTGGAAGCAACCTGAGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 22, 3: 125, 4: 461} {0: 2, 1: 14, 2: 231, 3: 540, 4: 1509}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!