ID: 967088574_967088580

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 967088574 967088580
Species Human (GRCh38) Human (GRCh38)
Location 3:186115759-186115781 3:186115773-186115795
Sequence CCACCTCCGCTGAGGCTCTGCTG GCTCTGCTGGGCCTGTGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 26, 4: 330} {0: 1, 1: 0, 2: 2, 3: 53, 4: 426}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!