ID: 967094718_967094720

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 967094718 967094720
Species Human (GRCh38) Human (GRCh38)
Location 3:186167906-186167928 3:186167929-186167951
Sequence CCAAGTTAGGTGTAGAAAATGCT GCAATTGAACTGCAGGATCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 111} {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!