ID: 967113717_967113718

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 967113717 967113718
Species Human (GRCh38) Human (GRCh38)
Location 3:186318174-186318196 3:186318189-186318211
Sequence CCTGGCTCTAAATTTTGCCCACA TGCCCACACTTTGACACACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 132} {0: 1, 1: 0, 2: 1, 3: 31, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!