ID: 967319673_967319680

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 967319673 967319680
Species Human (GRCh38) Human (GRCh38)
Location 3:188183261-188183283 3:188183279-188183301
Sequence CCACCTTCCTTATGTCCTCTTTG CTTTGGGGCTATGATTGAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 506} {0: 1, 1: 0, 2: 0, 3: 33, 4: 395}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!