ID: 967350628_967350635

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 967350628 967350635
Species Human (GRCh38) Human (GRCh38)
Location 3:188510527-188510549 3:188510565-188510587
Sequence CCCACATCAACACTAAGTCCCAA GCCCACTCTCTCCTTCGTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 168} {0: 1, 1: 0, 2: 0, 3: 13, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!