ID: 967373797_967373800

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 967373797 967373800
Species Human (GRCh38) Human (GRCh38)
Location 3:188778465-188778487 3:188778496-188778518
Sequence CCTTTAACCATTACATTCTGGAG AATCCAACCCTGCTGTAGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 143} {0: 1, 1: 0, 2: 1, 3: 2, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!