ID: 967462926_967462930

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 967462926 967462930
Species Human (GRCh38) Human (GRCh38)
Location 3:189767068-189767090 3:189767104-189767126
Sequence CCATATAACAAATCTTTCCCCAT TTTGCTTTCATACAAACAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 348} {0: 1, 1: 0, 2: 1, 3: 30, 4: 511}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!