ID: 967507821_967507823

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 967507821 967507823
Species Human (GRCh38) Human (GRCh38)
Location 3:190272989-190273011 3:190273036-190273058
Sequence CCATTGTTCATTTGTACATTCAG ATCTGGCTTTCCTGAACTTCAGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 26, 3: 107, 4: 507} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!