ID: 967536020_967536024

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 967536020 967536024
Species Human (GRCh38) Human (GRCh38)
Location 3:190604371-190604393 3:190604407-190604429
Sequence CCACTCTCCTCAATGACACTGGC TGTTAAGGTAGCCTGATTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 218} {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!