|
Left Crispr |
Right Crispr |
| Crispr ID |
967787605 |
967787609 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:193514384-193514406
|
3:193514423-193514445
|
| Sequence |
CCATCCATGTCCTGAAAAGGACA |
TATGGCTGCAGAGTATTCCGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 10, 2: 32, 3: 65, 4: 290} |
{0: 7, 1: 848, 2: 26022, 3: 13711, 4: 7892} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|