ID: 967791470_967791476

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 967791470 967791476
Species Human (GRCh38) Human (GRCh38)
Location 3:193553577-193553599 3:193553625-193553647
Sequence CCATTTCTGGTGACATTTGTGGA GTCAAATCTGAATGAAGTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 241} {0: 1, 1: 0, 2: 3, 3: 21, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!