ID: 967917986_967917990

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 967917986 967917990
Species Human (GRCh38) Human (GRCh38)
Location 3:194592995-194593017 3:194593034-194593056
Sequence CCATAGGAAGTCCCTCCTGGAAG TCCATACCTGCTCCGAGTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 163} {0: 1, 1: 0, 2: 0, 3: 2, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!