ID: 967987912_967987916

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 967987912 967987916
Species Human (GRCh38) Human (GRCh38)
Location 3:195109013-195109035 3:195109058-195109080
Sequence CCCAAAGGTATTATTATTTCCAA CTCAGGAAAGTGAACTCGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 404} {0: 1, 1: 0, 2: 0, 3: 16, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!