ID: 968008717_968008730

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 968008717 968008730
Species Human (GRCh38) Human (GRCh38)
Location 3:195259738-195259760 3:195259780-195259802
Sequence CCTCGGGTCTTTTGCCAAATTCC GAGGGGCCACCCCCACCACGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 89} {0: 1, 1: 0, 2: 0, 3: 23, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!