|
Left Crispr |
Right Crispr |
| Crispr ID |
968015781 |
968015787 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:195331392-195331414
|
3:195331426-195331448
|
| Sequence |
CCCGATCTTGGCTCACTGAGAAC |
CCTCAGCCTCCCGAGTAGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 48, 3: 1014, 4: 2785} |
{0: 99957, 1: 284367, 2: 226920, 3: 125442, 4: 164576} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|