ID: 968022922_968022927

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 968022922 968022927
Species Human (GRCh38) Human (GRCh38)
Location 3:195410890-195410912 3:195410904-195410926
Sequence CCTTCCACCTTCTGCCATTGAGG CCATTGAGGACACATCAACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 52, 4: 480} {0: 1, 1: 0, 2: 3, 3: 28, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!