ID: 968054866_968054872

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 968054866 968054872
Species Human (GRCh38) Human (GRCh38)
Location 3:195683777-195683799 3:195683804-195683826
Sequence CCAAGCCCATCCAGGGGCAACAG AGCCCTTTGAGGTGCACTGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 0, 3: 17, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!