ID: 968060249_968060256

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 968060249 968060256
Species Human (GRCh38) Human (GRCh38)
Location 3:195722330-195722352 3:195722373-195722395
Sequence CCTCCTGCCTGTGCTCACCGTGG TCCCGTTAGCTCCACCTTACAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 25, 4: 261} {0: 2, 1: 0, 2: 1, 3: 4, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!