ID: 968061518_968061527

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 968061518 968061527
Species Human (GRCh38) Human (GRCh38)
Location 3:195729691-195729713 3:195729725-195729747
Sequence CCCGGAAGACCTCACTGACCCCA AGGCTGATGCAGCAGGTGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 65, 4: 427} {0: 1, 1: 0, 2: 2, 3: 63, 4: 509}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!