ID: 968108558_968108562

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 968108558 968108562
Species Human (GRCh38) Human (GRCh38)
Location 3:196022404-196022426 3:196022433-196022455
Sequence CCACCTTTTGTGGAGGGCCTGAC CAGGCCCGCCTGCAGTTATCCGG
Strand - +
Off-target summary {0: 6, 1: 179, 2: 125, 3: 57, 4: 147} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!