ID: 968108559_968108562

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 968108559 968108562
Species Human (GRCh38) Human (GRCh38)
Location 3:196022407-196022429 3:196022433-196022455
Sequence CCTTTTGTGGAGGGCCTGACATG CAGGCCCGCCTGCAGTTATCCGG
Strand - +
Off-target summary {0: 1, 1: 20, 2: 160, 3: 114, 4: 194} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!