ID: 968125991_968125997

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 968125991 968125997
Species Human (GRCh38) Human (GRCh38)
Location 3:196160658-196160680 3:196160694-196160716
Sequence CCCAGAGATTAAAAGAAAAAACA TGATCAGGAGTAAATCAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 17, 3: 231, 4: 2090} {0: 1, 1: 0, 2: 0, 3: 10, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!