ID: 968125992_968125999

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 968125992 968125999
Species Human (GRCh38) Human (GRCh38)
Location 3:196160659-196160681 3:196160699-196160721
Sequence CCAGAGATTAAAAGAAAAAACAA AGGAGTAAATCAGCTGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 45, 3: 330, 4: 2658} {0: 1, 1: 0, 2: 1, 3: 18, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!