ID: 968205335_968205341

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 968205335 968205341
Species Human (GRCh38) Human (GRCh38)
Location 3:196794690-196794712 3:196794734-196794756
Sequence CCTGCTGTATAACTCAGCCAAAG GTTCAGCAACACCATGTTGTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 90} {0: 2, 1: 2, 2: 13, 3: 51, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!