ID: 968288218_968288222

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 968288218 968288222
Species Human (GRCh38) Human (GRCh38)
Location 3:197520425-197520447 3:197520442-197520464
Sequence CCGGGCAGGGGGTGAGTGCCTCC GCCTCCCCTCTGTGTGGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 239} {0: 1, 1: 0, 2: 4, 3: 29, 4: 325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!