ID: 968292650_968292659

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 968292650 968292659
Species Human (GRCh38) Human (GRCh38)
Location 3:197550671-197550693 3:197550690-197550712
Sequence CCACAGAGAGAGGGAGAAAGCCG GCCGATCTGCAGGGGGTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 422} {0: 1, 1: 0, 2: 1, 3: 28, 4: 414}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!